How to find complementary DNA, mRNA, and peptide sequences from one strand of non-template DNA?

How to find complementary DNA, mRNA, and peptide sequences from one strand of non-template DNA?
I'm in quite a predicament. I go to college a long way from home but decided to come home this weekend. Wonderfully, my bio professor emailed us an assignment due for Monday, but I don't have my textbook!

I would appreciate some help with this !!


So I'm given the sequence of non-template DNA and its orientation

5’ TACCATGTGGCAATGAGCTTAG 3’


I must write out the sequence of template DNA that is complementary and antiparallel to the above strand of non-template DNA and show its orientation.
(Wouldn't it just be ATGGTACACCGTTACTCGAATC? I am confused as to what antiparallel means though, and how can I find the orientation?)


After that, I need to write the sequence of mRNA that would be made during transcription of the template strand of DNA, and then show THAT orientation.


Then I have to find the sequence of the peptides made from the mRNA during translation, assuming there are no introns. I am allowed to use the three letter amino acid abbreviations to indicate them.
(I am very confused as to what an intron is without my book!)

There are so many websites that are confusing and complicated in the ways that describe how to perform these translation!! I would be super grateful if you guys could help me out!!


Answer
Template given: 5’ TACCATGTGGCAATGAGCTTAG 3’

You were correct about the complementary DNA strand: ATGGTACACCGTTACTCGAATC
Antiparallel is simply referring to the 5' and the 3' side. The 5' to 3' orientation of the original strand and the 3' to 5' orientation of the complementary strand.

From the original strand of DNA, the mRNA strand produced during transcription will be: AUGGUACACCGUUACUCGAAUC
Remember that RNA does not contain the base thymine. Instead it contains uracil and matches with adenine.

Sequence of peptides would be:
AUG - GUA - CAC - CGU - UAC - UCG - AAU - C..

The amino acids from the codons are:
Methionine (start codon) - valine - histidine - agrinine - tyrosine - serine - asparagine - ...

Introns are basically the "junk DNA". They are nucleotide bases or codons that do not code for the wanted protein. So ribozymes cut them out of the sequence.

Hope this helps!
Good luck.